Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD057H01
Clone ID 5SD057H01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD057H01
Sequence
GATCTCTCTGTAGTGGTAGGGACCTAACAGAAGAAAAGAGATATTTTATATTACTGCTTTTACAAGTTTTTTAACTTATT
AATATAGAAAT
Sequence Type genomic DNA
Unitrap ID UNI14434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92043216..92043306 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]

 
Come back to gene ENSMUSG00000058318


For any suggestions or comments, please send an email to unitrap@crg.es