Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD054G06
Clone ID 5SD054G06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD054G06
Sequence
GATCTGTAAAAGGACCTGCCCCGGACAGGAAGCACACTTTAAACTAGAGGAGGGGTAAGACTCGCTGGCCAATCAAGGCT
TCCGGGCGGAACTGCCAGTCACACAACGACTCGGTTTCTTCCGGAAGCCTTACTGGAAGTTTGTTTTTTGCTGTACAGGC
TTGAATGTTTCTCCGTGTCTTCTTTGAGCGCTGCTATTGGGTGCTGTGAGGGGACGTCAAGTAAGCTCCGTTTTTGAAAC
ATGGTGAGCGCATGGTTACTGTCTATAATGGATAGGGGCAGGTGGCTGAGCAGTGGGAGCTGAGGTGGTGG
Sequence Type genomic DNA
Unitrap ID UNI35925

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 74631230..74631540 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069208 (Zfp825) NP_666343 zinc finger protein 825 Gene [Source:MGI Symbol;Acc:MGI:2385315]

 
Come back to gene ENSMUSG00000069208


For any suggestions or comments, please send an email to unitrap@crg.es