Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE311D01
Clone ID 3SE311D01
Vector rsFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE311D01
Sequence
GGGCTTGAGTATATCTGACAGACAGACCCAACTGTCTCAAGTAACTTGCTTCAGAATATCCCTGAGGTTAAAACTGTGTT
ACATTTTACAATTAAATGGCTTCTCCTCCGGGTTCCTGATGAAGGATTTCCTCCAATAATTGCCTGAAGTATTGTTCAGT
GTGGAAGTAATTTACTGTTATTAAGATGCAATAGGATTATTGAAAGTGACTATACTAGTAAACTTTTTGGTTGTAAATGT
GGAAGGTTGGCTGTGTGGTTAGAAGTCAATCTCAGAATCCCACTGGAGATCCC
Sequence Type genomic DNA
Unitrap ID UNI31752

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20538450..20538736 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049800 (Sertad2) NM_001038625 SERTA domain containing 2 Gene [Source:MGI (curated);Acc:Sertad2-001]

 
Come back to gene ENSMUSG00000049800


For any suggestions or comments, please send an email to unitrap@crg.es