Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE311C10
Clone ID 5SE311C10
Vector rsFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE311C10
Sequence
GGGTCTCTCGTCCCCGGCGGCTCTCCGGGGGCTTCTTCCCGGGGTCCCAGCCTCCATCTCATCTGTCCCAAAGCCTCCTT
TCCCGGCGGGGCAGCCTGTGGAGATAACGTGTCTAGAGGTTAGAGGTTCGGGCTGTACCCCGGCGGGCTTGCACGCGAGG
CTCCCCGGGGCGGGTGGATTCCCCGGAGCGTGGGGTGGGGGTGCGCCCGGCCAGGTGGTGG
Sequence Type genomic DNA
Unitrap ID UNI12431

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45709885..45710106 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023944 (Hsp90ab1) NM_008302 heat shock protein 90kDa alpha (cytosolic), class B member 1 Gene [Source:MGI (curated);Acc:Hsp90ab1-001]

 
Come back to gene ENSMUSG00000023944


For any suggestions or comments, please send an email to unitrap@crg.es