Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE129E02
Clone ID 5SE129E02
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE129E02
Sequence
ACACTCATAAATATGGCTAGTTGATTGTGGTGTTGGGGATGGAATTAGGGCTTTGCATTTGTTTGCATTTGTTTAGCAAC
ATTCACTACTACATTCCCAATTTCTAAGTTAAATATTTACATTTAGTTCATTCAGAGTTTTGTACTGCCAAAGCATGGGG
TGGGGGATGTAGTTGATTTTTCAAGACAGGGTTTCTCTGTTTAACAGTCCTGG
Sequence Type genomic DNA
Unitrap ID UNI19584

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77400900..77401112 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017291 (Taok1) NM_144825 TAO kinase 1 Gene [Source:MGI (curated);Acc:Taok1-001]

 
Come back to gene ENSMUSG00000017291


For any suggestions or comments, please send an email to unitrap@crg.es