Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE125B03
Clone ID 3SE125B03
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE125B03
Sequence
CTTGGGCCAAGCTCAACCTGATGCTTACCAGCACCCACCCCTACTCCCATCACCGCCGCCTCACCCTAGATAAGGAAGCC
CTCCTAACCATTCTGCCCCGGCATCCTCATCCGTAAGATGGTTCGCAAAGCTAACTGGGGAATCTGTGAGTTATTTAGGC
TTTTGAGGCAGTTCCTGTCATAGAGCAAACACTGTGTATGTGTCTTGTTTCCTTCCAGGTGTAGCTAGTGAAAAGCAGAG
GCGGCTGCTGTACAATGTGGAGATGGAGCAGATGGCTAAAACAGCCAAAGCTCTGATGGAGGCCGTGAGCCATGCCAAAG
CCCCGTTTACCAGCGCCACACACTTGGACCATGTCCGGCCAATGTTCAAAGTGAGTGTCCTAGGGAATTAGCGTATCACC
AAGCCAGGCTCTGCAGGCGGCCTGCTGTAAAGTGTACGGCAG
Sequence Type genomic DNA
Unitrap ID UNI36929

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166686866..166687307 422
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074582 (Arfgef2) NM_001085495 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) Gene [Source:MGI (curated);Acc:Arfgef2-001]

 
Come back to gene ENSMUSG00000074582


For any suggestions or comments, please send an email to unitrap@crg.es