Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD046H02
Clone ID 5SD046H02
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD046H02
Sequence
TTGTCTTGTTGGTTTGAAGATTATCTTTCTGATTTTCAGTGATTCTGTTTACAGTTACTATACTCACAGGGTTTTAAGTT
TGTTAGAATACATAGATT
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108508097..108508193 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es