Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE113D07
Clone ID 3SE113D07
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE113D07
Sequence
AACTACAAAATGTCCTCTTAAGTTATAACTGGTTCTTTGCCAAATTCCACATTTAGGTATGTACCCTTTTAAAAGTTAGA
GTCTGCTTTTCAGATTTTGTGATTATCTGAGAAATTATTCAGTAGAATATTAAAAAAAAATTCCTCAGCTGCTTAGAAAT
CTGCCTTCTTTCCCCCCACCCCCCACCCCTCAAGCTTTATAGTACTCTGAATAGAAACAATAGACTCTTTTCTATTTGTA
ATTCATTATCTCTCAATTTGGGCATTAAGGACCTTGGGAAGCATCGGTGGGCACTTGAAAACCTCTGTAAATATTCCACA
GATACTCGAAAAACACAAAAGTACGATTTCTATTTCTGGGATC
Sequence Type genomic DNA
Unitrap ID UNI2859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55001974..55002335 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]

 
Come back to gene ENSMUSG00000060206


For any suggestions or comments, please send an email to unitrap@crg.es