Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE112G04
Clone ID 3SE112G04
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE112G04
Sequence
AGACTGAGTGAGGTGACTTACTTCTGTAATGCGCGTCCTTCATCCTGGCATGTTTGCTTGGGTATGGCACACGAGCAAGA
ATGGGAGTGGACGAGCTTGCTGCAAGAGGACTTCCAAAGCCTTCACTACTTTACATCATGGTTGCTGACATCCTCTTGGC
CAAAGGCAGGTGTGGCCTGTGACAGTGGAGGTTACATGGCAGAGGGTATGGTCACAGGAAAGGAGAAGAATTGAGCTTGT
TCTGCAGGCAGACCACCCTAGACTAAGAATTGCTGGATGAGATCACTGTCAACTGAGGGAGGAGTGAGGTCAGACATTTT
TTTTTGTCTCTGCCATGACTGTAGATTGTAATTTTAATTCTGGTTAGCAGCCTCATAAACAGACATCTGGGCTGTGTCAT
GGAAGAGACGGTTGATCGGGATC
Sequence Type genomic DNA
Unitrap ID UNI30985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 135572595..135573017 421
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039943 (Plcb4) NM_013829 phospholipase C, beta 4 Gene [Source:MGI (curated);Acc:Plcb4-002]

 
Come back to gene ENSMUSG00000039943


For any suggestions or comments, please send an email to unitrap@crg.es