Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE112D05
Clone ID 3SE112D05
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE112D05
Sequence
GTTTGTAAATGGCTGTGGTGGTTCTGTGAGGCATGTTGTTGGGGCCAGGGGTGAGAAGAGTTAAGATGGTCAGGACCTCA
AATAAGCAGAGGGCTTTTGTTAATTTGTAGTCTTTGAAGTGTACCAGGACTGACCTGGAGTTCTGTGGCAGGGCTTTAAC
TCTGG
Sequence Type genomic DNA
Unitrap ID UNI10778

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32977868..32978032 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056234 (AC154532.3-202) NP_001029160 nuclear receptor coactivator 4 [Source:RefSeq peptide;Acc:NP_001029160]

 
Come back to gene ENSMUSG00000056234


For any suggestions or comments, please send an email to unitrap@crg.es