Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE085D03
Clone ID 5SE085D03
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE085D03
Sequence
GATCTTGTAGTGGAAGATAGAGGAGGACTGCTAAACTAGGTTGAAGACTCAAAAGATTTCCCAAAAAGTGGGTTTAGGGC
TTGGCACTGCAGAAGGCAGAGGTAAATAGGCAGGAGGTAGGTTTGGGTGACGAGAGCCTGGCTCAGGTGAAAGCACGCGT
TGTGT
Sequence Type genomic DNA
Unitrap ID UNI17088

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102455217..102455381 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052414 (AC137156.3-201) NM_146065 Cyclic AMP-dependent transcription factor ATF-7 (Activating transcription factor 7)(Transcription factor ATF-A) [Source:UniProtKB/Swiss-Prot;Acc:Q8R0S1]

 
Come back to gene ENSMUSG00000052414


For any suggestions or comments, please send an email to unitrap@crg.es