Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD040B10
Clone ID 3SD040B10
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SD040B10
Sequence
TTCCTATGCTCGGTCCATCCCTCCGTAGAGGCGTGACTTAACGGCAACTCGCTTGATTGATACTTTAGCATCAGTATTTA
GGAGGCTGTAGTAGAGTTGTTAAGTTGATAAGTAAAAGCTGCCTTTACCGGCAGATCGAATCGGAAGTGGCATCTTTTCA
GTAGCGGTCATTCAGCAACCCTTGTTCGGAAATGACATTCCTGGCGTTCCCGATCTTGGATGTGATCTTTCCCACCAGCC
AGTTCTCCCAAATTCCTTTCCTGGTTTTCTTTCCTCTTTAGGGAACGCCACTCATCTCAGTAAAGAGCACCAGTTCCTTG
TCAGTTACCTGAGCTATTGAGAATAACTCAGTAAGCCTGGGTCAAAGTTAAACATAGTAAAGAGAAAAACAGATTTAGTC
TGGCCACACTGGGAGGAGAGACAAAGGTGTTCAGTGACACTACCTCTCCTACACACTCGTAGACGAGTCCATGAGGTTTT
AAGCAGCAGGCCAGATTTGTAAGAAGTCATTATTTTCTGCTCTAGTCTCCTGAGAGAAGTTTACCTACAGGGTGGCTCTC
AGGCTTTAGTCTTTTTCCTGTTCTATCGTGAGATTCCTTGGCTTGTGATTGATATTTTGTTTGTTTTCGTCTGTGTATGG
CACCAA
Sequence Type genomic DNA
Unitrap ID UNI4903

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88101515..88102160 646
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001416 (Cct3) NM_009836 chaperonin containing Tcp1, subunit 3 (gamma) Gene [Source:MGI Symbol;Acc:MGI:104708]

 
Come back to gene ENSMUSG00000001416


For any suggestions or comments, please send an email to unitrap@crg.es