Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST421061
Clone ID OST421061
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST421061
Sequence
GACTGAGGACTCAGACAGCATAGAATCTACTCAGCATCTCCTTCGCCACAGCCTCCCTTCCCCAACATCACATTAGCCTT
GAGTTGTGATCGACTGGCAGGAGCCCTAGCAGGCCTGAGAATAGCATCTGTATTATGGTAGAAAGCCCANAAATGANCCC
TGGGGAGAGGCTCTGGAGTTGGCCTGGANAAGGAGAGAGCATTACTATGTTGATAAGAGGGAAACATGGAAGACCAAACA
GAAGACACAGCTCCTATAGAGAGTCCCAGGCAAGCAAGCATTAACTCACAGCCATTCTGCCTGCATCTAAGTACCTGTGA
GAATCTGTTGGAAGCAGGACCAGTTGTATCATTTGCAGAGCCCAATGGAAAATAAAAACCAAAGTCAGTTGTG
Sequence Type mRNA
Unitrap ID UNI18540

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26322139..26323294 281
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007817 (Zmiz1) NM_183208 zinc finger, MIZ-type containing 1 Gene [Source:MGI Symbol;Acc:MGI:3040693]

 
Come back to gene ENSMUSG00000007817


For any suggestions or comments, please send an email to unitrap@crg.es