Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD032C06
Clone ID 5SD032C06
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD032C06
Sequence
CTGAGTTTGGCAGAGTGCTGATGTCAAAAACTGAGGGATATGT
Sequence Type genomic DNA
Unitrap ID UNI21607

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95021130..95021172 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038766 (Gabpb2) NM_172512 GA repeat binding protein, beta 2 Gene [Source:MGI (curated);Acc:Gabpb2-004]

 
Come back to gene ENSMUSG00000038766


For any suggestions or comments, please send an email to unitrap@crg.es