Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE079E12
Clone ID 5SE079E12
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE079E12
Sequence
TAAAATTGGCATGGGAAAGTACTTATTTCTTCAGAATTCTGGTACATAGTGAATATCAGCTGTAATAACCTGCAACATGA
GATAACCCGTCCTTGAATTTTCTAAGTTCCCTTGGCCGAGAGCCTTTCTATATTAGACATTAGAGAGACAATCTATTAAA
TTTCCTTTCTATATCCGTAGAGAAATTCATTCTGATTTGAGATATGTTTACCTAGAGAACCTGTCCTAATACAACTGTGG
CTTTTCTCTACTTTGCCACTGATGGCGATGTGCTGGCTACCAAGAGGGCTCAACAGTGTTTCCCTTACATTTCTGGCTTT
CCTCCCAGGGTTGTTTGGTATCATTTGGTGAAAGGGAGCTGTAGTCTTCTTGAGCCCAGCACTGAGCCACAAACAAAACT
CTTGTTTTTTAAAACCCTCTTTAATGTTCATTGCCTGGGCTCCCTCCCACTCAGATTGATAACCCCACTGCACCATGGGT
AATGGGCTATGCAAGCTCTTCCCCTGGATTTCAGGAAGAAGAAGGCAAGTGATGTGAGGCAAGCTCAGGCAAGGTCTGAA
GTCAGGTCCTGGTAATGCAGGATCATTGCTCACAG
Sequence Type genomic DNA
Unitrap ID UNI2455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 17897294..17897888 585
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079167 (CT030170.10)  

 
Come back to gene ENSMUSG00000079167


For any suggestions or comments, please send an email to unitrap@crg.es