Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE079E01
Clone ID 3SE079E01
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE079E01
Sequence
ATGATGTTACGCCTTTCCACTAGCAGTAATGAGTTTCAGTTGCTAGACAGTCTTCCGAATGGTGGGACCTGGCACATTTT
GCCTTTAGTCATTCTAAGCCCAGCTACATCATTTGG
Sequence Type genomic DNA
Unitrap ID UNI350

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62313903..62314018 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075009 (Tet1) tet oncogene 1 Gene [Source:MGI Symbol;Acc:MGI:1098693]

 
Come back to gene ENSMUSG00000075009


For any suggestions or comments, please send an email to unitrap@crg.es