Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE078E04
Clone ID 5SE078E04
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE078E04
Sequence
GATCTGTCTTCTCTCCTCTGTCCTGTCGACATGTTTCGTTCCTGGGCCACGATTGCAGCCTGAATGCTTCTCTTCCATCC
CTTTCCCTACATTGCCCTGACTGTCCTCTGGGTTTATAGCGGTGACAGCCCAGTATCTCTGGTCCCAGGCGGGCC
Sequence Type genomic DNA
Unitrap ID UNI10778

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32973473..32973627 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056234 (AC154532.3-202) NP_001029160 nuclear receptor coactivator 4 [Source:RefSeq peptide;Acc:NP_001029160]

 
Come back to gene ENSMUSG00000056234


For any suggestions or comments, please send an email to unitrap@crg.es