Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE067H07
Clone ID 5SE067H07
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 5SE067H07
Sequence
GATCCACCCAGACTTGATTCTGCTCTCTAGTTACCCGTTTGCTATCCTTTAAAAAACCGAGTCCATCCACTTACTTACTT
TGATATCTTTTGGTTTTTACTAAGTGTATACATACCAGGAGGGTGGGGAACTGGTTCATAGGCCACCTTGGGATCATTTC
TTTTTCTTTTTGTTTTTTCTGCCTCAGCCTCTTGAATGCAGGGATTATAGGCTAGCGACATGATATTTGTCTAAATGTCA
TTTATTCATTTTAGTTTATTTACTTTTCTAAAGACAGGGTCTCAGTCTGCAGGGTCCCAGGGTAACCTCAGACTCTTGGC
AACTGTTTATGCC
Sequence Type genomic DNA
Unitrap ID UNI11841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3167949..3168281 333
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054753 (AU018091) NM_001004153 cationic amino acid transporter 5 [Source:RefSeq peptide;Acc:NP_001004153]

 
Come back to gene ENSMUSG00000054753


For any suggestions or comments, please send an email to unitrap@crg.es