Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE064D11
Clone ID 3SE064D11
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE064D11
Sequence
CTGTCTGGAATCTGACAATAACAGTTACAGAGTCTGTTTTGGAGGGCTGGTAAAACCCTGCAGGCTACTTTTCACCAGGT
GTCCCCTTCAAAGTATATCATAATAATGTGATGTTTGTTTTCTTAAGGGAGCTACTTGAAGAATCTTTCATGTAGATATT
CATTCAAATAAAAACTTAGAAGACAGCTTTTAAGAAATTCATTTACATCTTTAGAAGACCAAAAGTGTCCTCATTTTCTT
CCGTGAGAATCAGCCAGAAAAGGTTGTAGTTCACATCACCACTTCCCCTATTTAGATTTAGCTAGCTCCCTGCCCCACAG
TTCCCTCATGATGAGTCTGCATTCTTAGAAAACATGCCGGTTCTAAATTACCACACAGGATTTAAATACTGACAGTTTGG
Sequence Type genomic DNA
Unitrap ID UNI16684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135083609..135084008 398
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028165 (Cisd2) NM_025902 CDGSH iron sulfur domain 2 Gene [Source:MGI (curated);Acc:Cisd2-001]

 
Come back to gene ENSMUSG00000028165


For any suggestions or comments, please send an email to unitrap@crg.es