Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE048A08
Clone ID 3SE048A08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE048A08
Sequence
ACATTTACATGTGGCAAGATTCTCTTTTAAAATCTTTTGAATTTCGGGCTTTTGCGGCCTAGGAGGTGAAGGGAGCA
Sequence Type genomic DNA
Unitrap ID UNI32635

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 106534815..106534891 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000016386 (Mpped2) metallophosphoesterase domain containing 2 Gene [Source:MGI (curated);Acc:Mpped2-001]

 
Come back to gene ENSMUSG00000016386


For any suggestions or comments, please send an email to unitrap@crg.es