Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE047F10
Clone ID 5SE047F10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE047F10
Sequence
GCCTGGTGCTCAGTGCTGTGGCCTATTTTAAAGTATCTTTAAGTTGTCGGCATGTCAGTCATTACATCCAGGGTTCCTTT
TCGTTTTCGAGGGCACCCTGTCTCTCCGTTTAGCCA
Sequence Type genomic DNA
Unitrap ID UNI32677

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 37946565..37946680 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039087 (Rreb1) NM_001013392 ras responsive element binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443664]

 
Come back to gene ENSMUSG00000039087


For any suggestions or comments, please send an email to unitrap@crg.es