Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE047B09
Clone ID 3SE047B09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE047B09
Sequence
AACATGCTATTTTCTTAAACACTGAATGTGTTCAGGTAGCTTGCTTATTAAATGTAGCCAGGTGGTCTTCTCATGGCTGC
TCACAGTACATCTGTATTTCCCAGCTGCATGGAATGCATAGGCAATCGCCATTTAGTTTTTAGCCCATCCTTTTGGACGG
TTTCTGTTTTAGTTTTACAAGTGGCTCCCACATGAATCTGGCCATCCAGCTGTCATTCTGCATGTGCGGTTGTATGAGGA
GGATGGTATTTCCGAGGTCACCAGTTAATTGCAGACC
Sequence Type genomic DNA
Unitrap ID UNI10776

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73613200..73613476 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070733 (Fryl) NM_177136 furry homolog-like (Drosophila) Gene [Source:MGI (curated);Acc:Fryl-001]

 
Come back to gene ENSMUSG00000070733


For any suggestions or comments, please send an email to unitrap@crg.es