Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE044B05
Clone ID 5SE044B05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE044B05
Sequence
GAGGGCCCTTCTTCCTGCAGTACCTCTACCAAGGGGAAAGCTCCCTGTGGTGCTGACTGAAGGAGAGGAGAGCGTGGAGC
GATCAGGAGATAGTGCCCACCCCACTGACATAAACCACCTGGGCTATTGCCTCCCAACACCCAGCTGTTGGCTATCTTGA
CTTTTTAAAGCAGAATTCTCCCGTGTTGCATATCTTGTAATAGCTCTCCAGCTGAACAGGGTTCTATATAAAAAGGTAAT
CCTTTTGTCAAACAAACATGAAATTAGAGCACACATAGGAATCATCTCCAAAGAACCTGACTTGTTGGGTAAGGTAGATA
GAAGTCACAAATGTGCATTTCTAATAGGTAACACCCAGTGATGGCAGTCTCTGAGACAAGGCTTTGATAATCCCTTACTC
TGTAGACCCCATACAAAGCC
Sequence Type genomic DNA
Unitrap ID UNI31092

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117561158..117561577 420
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025571 (Tnrc6c) NM_198022 trinucleotide repeat containing 6C Gene [Source:MGI (curated);Acc:Tnrc6c-001]

 
Come back to gene ENSMUSG00000025571


For any suggestions or comments, please send an email to unitrap@crg.es