Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD031C03
Clone ID 3SD031C03
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SD031C03
Sequence
TTGGCTGACCATGACACTTTGAGCTGGCTACTTGCAGCACAGAAATGGAGGAGGAAAAGGAAGGTGTCTTAGTCAGGGTT
TCTATTCCTGCACAAACATGCTGACCAAGAAGCAAGTTGGGGAGGAAAGGGTTCATTCGGCTTACACTTCCACCCTGCTG
TTCATCACCAAAGGAAGTCAGGACTGGAACTCAAGCAGGTCAGAAAGCAGGAGCTGATGCAGAGGCCATGGAGGGATGTT
CTTTACTGGCTTGCTTCCCCTGGCTTGCTCAGCCTGCTCTCTTATAGAACCCAAGACTACCAGCCCAGGGATGGTCCCAC
CCACAAGGGGCCTTTCCCCCTTGATCACTAATTGAGAAAATGCCTTACAGTTGGACCTCATGGAGGCATTTCCTCAACTG
AAGCTCCTTTCTCTGTGATAACTCCAGCTGTGTCAAGTTGACACAAAACTAGCCAGTACAATTGACCCCTTGACAACTTG
ACACACAAACACATCACTAGTAAGCCTCAACCCTTACATTCTTATTCATCCCCAAG
Sequence Type genomic DNA
Unitrap ID UNI36940

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176984360..176984883 510
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078870 (OTTMUSG00000016578) NP_001107278 predicted gene, OTTMUSG00000016578 Gene [Source:MGI Symbol;Acc:MGI:3709158]

 
Come back to gene ENSMUSG00000078870


For any suggestions or comments, please send an email to unitrap@crg.es