Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD029E12
Clone ID 3SD029E12
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SD029E12
Sequence
GGGTTTGTGAGTGTCCTTCCTCTCTGGGACCCCCTTGTAAGGCCTAGNNNAGCTAGACTAGCCAACTGGTGGTGGTGGGG
GGACTGCCTGGCCAGACGGTAATTGTTTTTATGGTAATTGTTTTTATGGCTTGTTTCTTTGATACAGAACCATGCTGTAT
TGAAGGAGTGGGAAGTGCGGTTGGACCTGTGACCTGTTGGTCCTTATCTTAATGAGTTCTAGACAGGTCTTTCTTATATA
ACAGCCCAATTTTGAGTTAGAAAATTGTATTAAATTGGACCAATCTAGGGAGTTGGGCTAAAAGAATTGTTTAAATGAAA
ACATCCAGAAAATTGGGCCTGGTTCCCAGGAGTCTTACCTTGAGAATCTCTTCTTTACTCTCAGACCCTGATTGTGCACA
CACTTTGGGGCAGTGTGGCCTTCCCTGCTTTTATTTTCAGGCGACCTTTGCACCTCTCAGTTAGCATTCTTATCTATCTA
AAACCACCAAAAGCGGTTTTGGACTATCCCTTCACTTTTGGAGCCATGAATTCCTTAAGTATCCTGTCTTGAATATTTTA
ATATTTACACT
Sequence Type genomic DNA
Unitrap ID UNI13352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 22295987..22296557 565
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029672 (D6Wsu176e) NM_138587 Protein FAM3C Precursor [Source:UniProtKB/Swiss-Prot;Acc:Q91VU0]

 
Come back to gene ENSMUSG00000029672


For any suggestions or comments, please send an email to unitrap@crg.es