Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD026F06
Clone ID 5SD026F06
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD026F06
Sequence
GATCCCTTCTGCTGGCCTCTTCTGGAGGAGTTCAAGGCAGACATGTTTGTGCCCTGCACTCCCACACTGCCCCCTTGGCC
GTGGGTTGTCTGGGTTAGGGGGGGATTGGCTTTGTGTAGACTCCTGTGTGCTTCCAATTTGTGTGTGGGAGGCTGTGAGC
GGTGGGAGGGGAGAGAGTGAGTGGGGAGGCTTGAGAAATAAGTGTAGTCGATGACATCACAGTGACAGAAGTCAGCCTGG
GGACATCAAGTCACAATGCAGTGAATGGCTTTCTTTTTGTCCCCAGGGGAGGAAGCCTGAAGAAGAATGGCCAACTCTAG
TTCTCAACACATGGTCTGTG
Sequence Type genomic DNA
Unitrap ID UNI18002

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28521668..28522008 337
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037640 (Zfp60) NM_009560 zinc finger protein 60 Gene [Source:MGI (curated);Acc:Zfp60-001]

 
Come back to gene ENSMUSG00000037640


For any suggestions or comments, please send an email to unitrap@crg.es