Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD022H11
Clone ID 5SD022H11
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD022H11
Sequence
GTGATGAAAAGGAGAGGGGAGAGTTAAGTAAGAGTTTATTTAAAAGGACACCAAAGCTGATGTGCTAGACAGCAGAAAGG
TACT
Sequence Type genomic DNA
Unitrap ID UNI2640

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 22894332..22894416 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036782 (Klhl13) NM_026167 kelch-like 13 (Drosophila) Gene [Source:MGI (curated);Acc:Klhl13-001]

 
Come back to gene ENSMUSG00000036782


For any suggestions or comments, please send an email to unitrap@crg.es