Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE041F01
Clone ID 5SE041F01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE041F01
Sequence
ATAGAACTCAGAAAGTTAAGAGGGTCCTTGCTTTTTATGATAAAGACATTTATGAAAAATATAGCTAACA
Sequence Type genomic DNA
Unitrap ID UNI22924

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 25751098..25751167 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029676 (Pot1a) NM_133931 protection of telomeres 1A Gene [Source:MGI (curated);Acc:Pot1a-001]

 
Come back to gene ENSMUSG00000029676


For any suggestions or comments, please send an email to unitrap@crg.es