Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE041E04
Clone ID 5SE041E04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE041E04
Sequence
GATCTGTATCACTTTTCTTTGTGTTTCCAGAGATACGGGTAGTCGATTATTATCCTTTTCTAGCCATTATGATTAATGAA
AAGTGTTGCTAAATATTAAGAC
Sequence Type genomic DNA
Unitrap ID UNI14706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 32262875..32262976 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027663 (Zmat3) NM_009517 zinc finger matrin type 3 Gene [Source:MGI (curated);Acc:Zmat3-001]

 
Come back to gene ENSMUSG00000027663


For any suggestions or comments, please send an email to unitrap@crg.es