Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE040E08
Clone ID 3SE040E08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE040E08
Sequence
ATAGTATTTTTGNNNGTTAGGAGGAAAAATTCTGGAAATTTTTGACACAAAATCATATGAAGGTACTTGTCTGGATTGTT
GAGTATTGGCCAGAAATAATGATCATGTGATAAGAACTGCAATTATAACAAGTAATATAAAGGTGAACTTTACAATGCTG
TTTTGAGGCATAGCTTTTCTGTTCTTTCTCCTTTCCTATGGGAAGTGTTTATTGACCAAGTTCTCTGGATTACAGAGGGA
AACTACCATCTTGCCTTCCCCCACCCACTTCCCCACACACTCTTAGAAACTGCACCTGTCCTTCAAACAGCTGTCTTTGT
GGTAAAAGTCAAAGTTCATTTCTTTTATAAGAAAACAATA
Sequence Type genomic DNA
Unitrap ID UNI17538

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 35987315..35987673 352
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048970 (C1galt1c1) NM_021550 C1GALT1-specific chaperone 1 Gene [Source:MGI (curated);Acc:C1galt1c1-001]

 
Come back to gene ENSMUSG00000048970


For any suggestions or comments, please send an email to unitrap@crg.es