Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE031C01
Clone ID 5SE031C01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE031C01
Sequence
GCTGTAGTGGGTATTGCATGCATAATTGAATATACAAAGAAAGGACCCTGGGCCTTAAAATGGAAATTACTTGGTTTGCG
GGACTAGATCGTTCTTTTAAATGTAAATATTCCAGACTAGGGCTCTGTCTGCTTGTAGGGTGTAACTGCAGAGTTTGGGA
GGTTTTAGCTATCTAAATCTTTTGCTCTGTGATCCCACAGTGAAGGAGCTGCTGTTGCCCTGAAGCCCAGCTGACTTTTC
CATGCTAATGAGGGACTATGGGCAGGACTAACAATCAGGAACACTAGGGGAAGGTAGCTTACAGGTTCTTTACAGGATTC
TCCTCAGATGCATCTGTTAAAAGCTGCCTGGAAGACCACAAGCCATCCCCTGGTTATTATAGTAATCTCTGTTACAGTAC
AGTAGGAGCAAGTCTGCAGAGCTATTTGAGTCCGATCTGCTGATTCTAAATGGACTGTGGATCACAGTTTGGTTCTGTTG
GTCCATGTGGTGATCATAGCAGAGGCCCTTGTCCTTTGACTTCCTGACTGTGGATTTACAGGGGTAGGGGTGGCTCGGTA
GCCCTGGGAGTGGGAATGTATGGAACTTAAATGTGACTATGCAGTATGCACATACAGGCATTGCCTTTGGTGTGCCGTAG
GACAACATTGGAAAAGTAATGGTTTGATTTCTAGAATTCATGACCCTTCTGTATTCAGTTTTGTGTTTCTAGTTTTATAA
ATAGTTTAGAAGGTAGTAG
Sequence Type genomic DNA
Unitrap ID UNI6522

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177570438..177571176 735
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078863 (OTTMUSG00000016325) predicted gene, OTTMUSG00000016325 Gene [Source:MGI Symbol;Acc:MGI:3702875]

 
Come back to gene ENSMUSG00000078863


For any suggestions or comments, please send an email to unitrap@crg.es