Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD010D01
Clone ID 5SD010D01
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD010D01
Sequence
GATCTAGGGTAGGAGCAGGCTTATGTAACTTTTGTGAAAATGGTATCTTTATAAGTAAGATTGAATCATTGCTCTTAGTG
GGGTGGCTGACAATCTGGAAACAGAAACAGGTGTGTGGGCATTGCCTCTCTGATGCTGACTGGCAGGTTCTTCTGACCAA
GACCGTAAAGGGCATCTGAGTGATATCAGCTGTCTGGTTATGTGTGCGTGCGTGTGCGCTGG
Sequence Type genomic DNA
Unitrap ID UNI951

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127537780..127538001 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040054 (Baz2a) NM_054078 bromodomain adjacent to zinc finger domain, 2A Gene [Source:MGI Symbol;Acc:MGI:2151152]

 
Come back to gene ENSMUSG00000040054


For any suggestions or comments, please send an email to unitrap@crg.es