Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD007G09
Clone ID 3SD007G09
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SD007G09
Sequence
ATAGCTGGTGAGATAATAGTGATTTTATCGTTTTTTGAAAATTCTGGAATTGTATTACCAAAGTTCTGGGGGAAAATGTA
TGTATTTTGGG
Sequence Type genomic DNA
Unitrap ID UNI20161

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150733460..150733551 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059119 (Nap1l4) NM_008672 nucleosome assembly protein 1-like 4 Gene [Source:MGI Symbol;Acc:MGI:1316687]

 
Come back to gene ENSMUSG00000059119


For any suggestions or comments, please send an email to unitrap@crg.es