Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SP136E09
Clone ID 5SP136E09
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SP136E09
Sequence
AATTTTTATCGATGGCTTCTGGTCTGGATATTTTT
Sequence Type genomic DNA
Unitrap ID UNI10969

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62365386..62365420 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019505 (Ubb) NM_011664 ubiquitin B Gene [Source:MGI (curated);Acc:Ubb-001]

 
Come back to gene ENSMUSG00000019505


For any suggestions or comments, please send an email to unitrap@crg.es