Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD186H07
Clone ID 5SD186H07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD186H07
Sequence
AGGTACATAGCATGCTAACCCGGCCTGCTAGAGAACAGTATGGGTGTGTTTGTTTACCAGGATTGTCCAGACATTTGTCT
CCAAACTATAAAAATAGAGACAGCTTTCCTTTACAATCAACAACAAGGCCCATCTTGATAGCAAAGAACAGGCACCTAAC
AAGGTGCTCAAGATGGCATTATAG
Sequence Type genomic DNA
Unitrap ID UNI7604

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150310026..150310209 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074731 (Zfp345) NP_001030072 zinc finger protein 345 Gene [Source:MGI (curated);Acc:Zfp345-001]

 
Come back to gene ENSMUSG00000074731


For any suggestions or comments, please send an email to unitrap@crg.es