Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD186F09
Clone ID 5SD186F09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD186F09
Sequence
TCAGATAACCTGCTGGGATGAAGAATAAATATCTACTTTATACTACAATGATTTTAAACTACTGTATTATTTAAATTAAT
ATACTTCATTGAAAACATGATTCAAATGATGAAGTATGATGGGGTTTTTTTATATTAAAAGTGAAGTACAGGCAGTATCT
TGTATAAAATCATTATGAAATTGGACATAAATTATCTTATAGTTTAAAATAAATATTTAAGTCATTATGTATTTTTAGAA
TAACTGGTAATGGTTGCAGTGCCTGGACACATTGCACTGGTCCATCAGGAGGAAGCCCGCACTGTAGAATTTATTATGGA
CACTATCTACCTATGTGGCTAGAAAGTATCCCCATGAGGTAGGAATTAGAAGTTAGATAACATGGGCAT
Sequence Type genomic DNA
Unitrap ID UNI16134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84795889..84796277 389
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]

 
Come back to gene ENSMUSG00000053062


For any suggestions or comments, please send an email to unitrap@crg.es