Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD185H07
Clone ID 5SD185H07
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD185H07
Sequence
GATCCTTCTCCATACTGCTTCTAGACAGCATGCTTAATTCTATAAATATTACTGGTTATTGTATATGCATTATATCAGTG
TATAAATCATCTTGAGGAGAGTTGATGTTTTTGTAAATTTATATCTTTTGGCTCAGAAATGTGATTTTATTTAGTCTTTT
GTCCTACTTTATAGCATCTTATTTATTTATTCATTTGTT
Sequence Type genomic DNA
Unitrap ID UNI36819

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 32314722..32314920 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027665 (Pik3ca) NM_008839 phosphatidylinositol 3-kinase, catalytic, alpha polypeptide Gene [Source:MGI (curated);Acc:Pik3ca-001]

 
Come back to gene ENSMUSG00000027665


For any suggestions or comments, please send an email to unitrap@crg.es