Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD181G05
Clone ID 3SD181G05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD181G05
Sequence
CTCTGACCTCCACCTGCATGCCCAAGCCATGTGCGTGT
Sequence Type genomic DNA
Unitrap ID UNI1099

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 132316162..132316199 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043384 (Gprasp1) NM_001004359 G protein-coupled receptor associated sorting protein 1 Gene [Source:MGI (curated);Acc:Gprasp1-001]

 
Come back to gene ENSMUSG00000043384


For any suggestions or comments, please send an email to unitrap@crg.es