Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD179H12
Clone ID 3SD179H12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD179H12
Sequence
AGGCTTCAGTTCTTTCATGGGAGATGCTCGCAGGGCTGAGGACCAGCCTCAGACAAATGCCTGTCACATGCAGGGCTGGC
GCTGGAGGCAGGG
Sequence Type genomic DNA
Unitrap ID UNI36948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 131362737..131362829 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078591 (Hs3st4) heparan sulfate (glucosamine) 3-O-sulfotransferase 4 Gene [Source:MGI (curated);Acc:Hs3st4-001]

 
Come back to gene ENSMUSG00000078591


For any suggestions or comments, please send an email to unitrap@crg.es