Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD175B07
Clone ID 5SD175B07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD175B07
Sequence
AGTAGTTAACAAAGCACTGGGGGGCAAGGTCAAACACTATCTCATTAATGCCATTCCTTCTACAAAGAAAGGCCTGATCC
TTTTCTAATCAGTACAGTGA
Sequence Type genomic DNA
Unitrap ID UNI4931

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176859688..176859787 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078872 (OTTMUSG00000016569) predicted gene, OTTMUSG00000016569 Gene [Source:MGI Symbol;Acc:MGI:3650075]

 
Come back to gene ENSMUSG00000078872


For any suggestions or comments, please send an email to unitrap@crg.es