Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SP131A05
Clone ID 3SP131A05
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SP131A05
Sequence
AATGGTAAAGCTTGGTATCTCACAATAGGCCTTTCATGAGCATACCTAGATACACCCCTGGGAACTCAGGTAGTCATTAA
AAATGGGCGGTGTAGGCTGTTGGCAGCTCAATTACAGCTCTGCAGCTGCTGTCTAGGAAGTCACTGTGTCTCTGCAGTGG
TCTCCGGAGCTTGGAACAGTTCTAGCTGTCTAATCATAGATTCTCTACTCATAGCAAGGGGTCTGCAGAAATCAAGAAAG
GGCCTGTTTGGCAATAGAGGCCACAGTCACACCTGCATCGAGATGCCAANNNCTTGCAACCCAGCTGTGAGACTAGCTTT
AGCAGGGATTGGTCTAGTCGTCCGGCTAGCACATGAGGGTATGGCTCTGATCCTCGTAGCTGAATTGTCTCTGACAGTCC
TGATCAGTGTTAGACTGCTGTTGAGTCTATCTTTAATTTTGCCAGTTTAG
Sequence Type genomic DNA
Unitrap ID UNI18001

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 145898892..145899345 426
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029623 (Pdap1) NM_001033313 PDGFA associated protein 1 Gene [Source:MGI (curated);Acc:Pdap1-001]

 
Come back to gene ENSMUSG00000029623


For any suggestions or comments, please send an email to unitrap@crg.es