Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SP126F09
Clone ID 5SP126F09
Vector ROSAbetageo+2
Project ggtc

SPLK-Sequence tag 5SP126F09
Sequence
AATTTCTGTGCCTAATGTAACTACTCTTTAGTATCTGACTTCCTGTATTGAGTTTAGCATTAAGTAAACATTAGCAAAGA
GACTTAATAC
Sequence Type genomic DNA
Unitrap ID UNI1642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108161930..108162019 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005698 (Ctcf) NM_007794 CCCTC-binding factor Gene [Source:MGI (curated);Acc:Ctcf-001]

 
Come back to gene ENSMUSG00000005698


For any suggestions or comments, please send an email to unitrap@crg.es