Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SP124H05
Clone ID 5SP124H05
Vector ROSAbetageo+2
Project ggtc

SPLK-Sequence tag 5SP124H05
Sequence
AATTCTGAGTGGAAGTTATAAGATAGACCGGTCTTCAGTGTGTACAGAGAGCATATGAATGAAGGAAGACCTGTAAACTA
TGAGCAACAACTTGGTGTGATTTGTAAGGGTGGGTATGGGAGTGGAGATTATATGGTGACCTGTATAAATAATGAGCCGT
ACTTTTGTGATATCTGTCATGGATCAGGGAGCACTGCTGGGGATTGAATCCAGGGCTTGATACATGCTAGACAGGTACCT
TATGCCTCCTCTGTGTATTTTGAAATAATCTTAAGTGCTCAGTCTAGTCTTGCACTTGAGATCTCTGTTCCTTCACCTCA
AGTGCTCCACCAGGCTTCATTATTACAGATTTTAGTTTAACATTTGTGTGAGGAAAGGAACTGGTTCTAATGTTTTCACC
GAAAAGTATTTTGAAGACTTTTTTTTAGGGATATAGTTTACAGAAGATCAATTCAGGGCAGGGCATTGTGCATGGGACAT
CAAGGTATGATTAAAGAGCCAGTAAACAAACTTACTTCCCTCTGCAAAAAC
Sequence Type genomic DNA
Unitrap ID UNI29510

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30093723..30094253 531
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es