Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD174C01
Clone ID 3SD174C01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD174C01
Sequence
CAACTGGCTTTTTTGTAGTTTAAATCTTTCTTAGAACATGGGTTTGCTCCCAAGGAAGGCCTGTGGTTAAATCACTTCAG
AGGAGCAGCTAGTTGTCTCTCTTCCGTTTACAGAGTGAAGGCAAGTTTTCCCCTGACCTGGTTTGAATTAGCACTGTGTC
AAACACCAACTTCTTATTTATTTACTTAATTATCTATACATAGG
Sequence Type genomic DNA
Unitrap ID UNI14379

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 86542867..86543070 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024135 (Srbd1) S1 RNA binding domain 1 Gene [Source:MGI Symbol;Acc:MGI:1925836]

 
Come back to gene ENSMUSG00000024135


For any suggestions or comments, please send an email to unitrap@crg.es