Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD171F11
Clone ID 5SD171F11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD171F11
Sequence
GGATCCGGCCGAAGGATAGGGGGCGAGGCCGGCCTAGGAGGCTGCCCCCCAACCCCATTTGTGATAGTTTTAGAGTGCGT
CCCACCAGTTTGAGCTGTAGGGACCTCAAAGTTGATCCGCTTCCCACCCCGGGACAAATAGGAGAGAAAGTGTTATTTCT
GCGTAGTAATTTTTCTGCAGGGACAGCCTTTTCCCCTTTTTGCTTCTTCAGTCTCATTCAGCCACGGAAAAGCTTGATGT
TCCCTGTAACCTGAAAAACGAG
Sequence Type genomic DNA
Unitrap ID UNI20573

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 121062741..121063002 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034667 (Xpot) NP_001074525 exportin, tRNA (nuclear export receptor for tRNAs) Gene [Source:MGI Symbol;Acc:MGI:1920442]

 
Come back to gene ENSMUSG00000034667


For any suggestions or comments, please send an email to unitrap@crg.es