Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD166E05
Clone ID 5SD166E05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD166E05
Sequence
GATCTGATTAAAATCCTTTTACCTTTCCACTATCACCAGTCAAAATGCATGAAGTGATTCAGGGAAATTCAGTTCCAGGG
TCCAAAAGGAGTTTCTGAGATGTAAAGGTTTCTTAAGTGTGCATGGTGGTGTGCAGGTGGGTAGGGCAGATTCTATATCA
TATGCTATAATCCAGGTGGCAGGAAGCAGATATTAAAATTATTCTTCAACCTTGGTTTGTGTGTGGGCTCAATAGGGCTG
GGTTTGTGCAAGAACACAAAGGGGCATTAGGTTCAGCAGAGCTCTAGCCCATCTTTCTGATGACGTCCATATAGAGAGAG
CTCTGGGGCCTCTGTTTGGAAGTGGGACCAGTAGTAGCTGGAGGGATCAGAAATGTACCAGTTAGGGGTCACTTTGAATA
ATTTTTGTGGGAGTTGTGAAGTCTGTTTTTATTCCATTTGTATACATATGCAGTCATGGGTAATATTGGTCATGTTCACA
TTTTTCCTGACTGAGTTTCCTTAGGTCTTTTGATTGAAACTTGACTATAATTTGGGGCTTATATTTGGGACTTTTTTTCT
CTACATCTCATTATTTTTTCATGAATGTTAT
Sequence Type genomic DNA
Unitrap ID UNI4672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98299396..98299986 591
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074887 (A630089N07Rik) RIKEN cDNA A630089N07 gene Gene [Source:MGI Symbol;Acc:MGI:2444323]

 
Come back to gene ENSMUSG00000074887


For any suggestions or comments, please send an email to unitrap@crg.es