Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SP116G11
Clone ID 3SP116G11
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 3SP116G11
Sequence
TTTATAGTTGNNGAGCAGACGAGTGGAGTATGTGAGCATAGTCACACCATGTTCTTAGTTTGGCTGTAGAGTGTATGGAT
GCAGTTATACTAGGTTCTTAGTGTGGCAGACTGTATGAGAGCAGTCACACCAAGTTCTTAGTGTTCTCATGGAAATCTCA
TGTTGTATTGCTTTGTACATGTATCTTAATTAGAAGACTGATCCTGTGTGCTGATAGAACTATTGATTGATTAGGCAGGA
TCTCACT
Sequence Type genomic DNA
Unitrap ID UNI14917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94801499..94801746 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074897 (CT030190.9) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3USJ7]

 
Come back to gene ENSMUSG00000074897


For any suggestions or comments, please send an email to unitrap@crg.es