Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SP116G08
Clone ID 3SP116G08
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 3SP116G08
Sequence
CTGGGTTTTGAAGTGGTTCGGTTTGTGGAATATTTGTAGGTCTGACAGATGAGCGTACCTAATCTGGAAATCCAAAATGT
GCTCGAAAAGAAGTGGGTTTTGGGACGTTCTGA
Sequence Type genomic DNA
Unitrap ID UNI20161

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150733974..150734086 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059119 (Nap1l4) NM_008672 nucleosome assembly protein 1-like 4 Gene [Source:MGI Symbol;Acc:MGI:1316687]

 
Come back to gene ENSMUSG00000059119


For any suggestions or comments, please send an email to unitrap@crg.es