Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SP116E09
Clone ID 3SP116E09
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 3SP116E09
Sequence
CCAATTTTTCCATTTTTTTAAAGGCATCCATTACCTGGGAAAACACAGGCACACCTGTGCAAATGCCTGAAGCAGCTAAG
GTGTTTCCTGTATATTGAATGTTGAATGGCATTTGTGAACCCCTCATTTGATACTTCGTTGAAAGACATACAATTCCTCA
TTTAATACATTAGACTTGAAAATGTTTTCTATACAAAAGAGGAAAAGTTTATATGATAAAGAGCAAAAAACCTTATGGAA
TTAACCATAACTCATATTGGAAGTGGCAGGAAAGAGAGGTGAGGGCCAGGGAGGCTTGGATAGAGCCTAACACCTGGACC
TTTTTAGCTTGTCCAGTCTGGTGATAGACAGTATTTTGAGGCAGTAGAATATA
Sequence Type genomic DNA
Unitrap ID UNI15573

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 120485849..120486222 370
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032897 (Nfyc) NM_008692 nuclear transcription factor-Y gamma Gene [Source:MGI (curated);Acc:Nfyc-002]

 
Come back to gene ENSMUSG00000032897


For any suggestions or comments, please send an email to unitrap@crg.es