Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SP115F05
Clone ID 5SP115F05
Vector FlipROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP115F05
Sequence
GATCCCTAATGGGCATGTTTGGAGGTTGTGGGGCCCGGGTGGCATTCAGTGGGTGTCTACTTTTGAGGAGACACTTAGGA
AGCGGTGCTTGGGGATTCGGGTGGCATTTAGGAGTCTGTTTTATGAGGTAATTCTCTGACGCAGATTTATACCCCTTGGA
AGCAGGGCTTAGGGGGGACTTGGGG
Sequence Type genomic DNA
Unitrap ID UNI36951

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 20235728..20235912 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001924 (Uba1) NM_009457 ubiquitin-like modifier activating enzyme 1 Gene [Source:MGI (curated);Acc:Uba1-001]

 
Come back to gene ENSMUSG00000001924


For any suggestions or comments, please send an email to unitrap@crg.es